MCP Sequence Simulation Server

Simulate DNA and amino acid sequences using evolutionary models and algorithms.

An MCP (Model Context Protocol) server for simulating DNA and amino acid sequences using various evolutionary models and algorithms. This server provides powerful tools for sequence generation, mutation simulation, evolutionary modeling, and phylogenetic analysis.

- Random DNA Generation: Generate sequences with specified GC content
- Markov Chain Models: Context-dependent sequence generation
- Codon-Biased Generation: Realistic protein-coding sequences
- Customizable Parameters: Length, GC content, seed for reproducibility

- NGS Read Simulation: Generate realistic next-generation sequencing reads
- Platform-Specific Models: Illumina, 454, Ion Torrent, and PacBio quality models
- Paired-End Support: Both single-end and paired-end sequencing reads
- Error Modeling: Configurable sequencing error rates with realistic quality scores
- Coverage Control: Generate reads to achieve specified coverage depths
- NEAT-Based: Implementation inspired by published NEAT methodology

- Random Protein Generation: Uniform amino acid distribution
- Hydrophobic-Biased: Membrane protein-like sequences
- Disorder-Prone: Intrinsically disordered protein sequences
- Custom Composition: User-defined amino acid frequencies

- Substitution Mutations: Point mutations with transition/transversion bias
- Insertion/Deletion Events: Indel mutations
- Multiple Iterations: Track changes over time
- Both DNA and Protein: Support for nucleotide and amino acid sequences

- Population Evolution: Simulate populations over generations
- Selection Pressure: Configurable fitness functions
- Lineage Tracking: Follow individual evolutionary paths
- Fitness Functions: GC content, length, hydrophobicity targets

- Tree-Based Evolution: Simulate sequences on phylogenetic trees
- Multiple Substitution Models: JC69, K80, HKY85, GTR
- Molecular Clock: Uniform or variable evolutionary rates
- Multiple Output Formats: FASTA, NEXUS, PHYLIP

Add to your Claude Code MCP configuration:

{ "mcpServers": { "sequence-simulation": { "command": "node", "args": ["dist/server.js"], "cwd": "/path/to/mcp-sequence-simulation" } } }

Generate random DNA sequences with various models.

- length(required): Sequence length
- gcContent(optional): GC content ratio (0-1, default: 0.5)
- count(optional): Number of sequences (default: 1)
- model(optional): "random", "markov", or "codon-biased"
- seed(optional): Random seed for reproducibility
- outputFormat(optional): "fasta" or "plain"

{ "length": 1000, "gcContent": 0.6, "count": 5, "model": "markov", "outputFormat": "fasta" }

Generate random protein sequences with various biases.

- length(required): Sequence length
- count(optional): Number of sequences (default: 1)
- model(optional): "random", "hydrophobic-bias", or "disorder-prone"
- composition(optional): Custom amino acid frequencies
- seed(optional): Random seed
- outputFormat(optional): "fasta" or "plain"

{ "length": 200, "count": 3, "model": "hydrophobic-bias", "outputFormat": "fasta" }

Simulate FASTQ sequencing reads with realistic quality scores and error models.

- referenceSequence(required): Reference DNA sequence to generate reads from
- readLength(required): Length of each sequencing read (50-300 bp)
- coverage(required): Target sequencing coverage depth (1-1000x)
- readType(optional): "single-end" or "paired-end" (default: "single-end")
- insertSize(optional): Mean insert size for paired-end reads (default: 300)
- insertSizeStd(optional): Standard deviation of insert size (default: 50)
- errorRate(optional): Base calling error rate 0-0.1 (default: 0.01)
- qualityModel(optional): "illumina", "454", "ion-torrent", or "pacbio" (default: "illumina")
- mutationRate(optional): Rate of true mutations 0-0.05 (default: 0.001)
- seed(optional): Random seed for reproducibility
- outputFormat(optional): "fastq" or "json" (default: "fastq")

{ "referenceSequence": "ATCGATCGATCGATCGATCGATCGATCGATCGATCG", "readLength": 150, "coverage": 30, "readType": "paired-end", "errorRate": 0.01, "qualityModel": "illumina" }

Citation:Based on Stephens et al. (2016) PLOS ONE 11(11): e0167047.

- sequence(required): Input sequence
- sequenceType(required): "dna" or "protein"
- substitutionRate(optional): Substitution rate (default: 0.01)
- insertionRate(optional): Insertion rate (default: 0.001)
- deletionRate(optional): Deletion rate (default: 0.001)
- transitionBias(optional): Transition vs transversion bias for DNA (default: 2.0)
- iterations(optional): Number of mutation rounds (default: 1)
- seed(optional): Random seed
- outputFormat(optional): "fasta" or "plain"

{ "sequence": "ATGCGATCGATCG", "sequenceType": "dna", "substitutionRate": 0.02, "iterations": 5, "outputFormat": "fasta" }

Simulate sequence evolution over multiple generations.

- sequence(required): Starting sequence
- generations(required): Number of generations
- populationSize(required): Population size
- mutationRate(required): Mutation rate per generation
- selectionPressure(optional): Selection strength (0-1)
- fitnessFunction(optional): "gc-content", "length", "hydrophobic", or "custom"
- targetValue(optional): Target value for fitness function
- trackLineages(optional): Track individual lineages
- seed(optional): Random seed
- outputFormat(optional): "summary", "detailed", or "fasta"

{ "sequence": "ATGCGATCGATCG", "generations": 100, "populationSize": 50, "mutationRate": 0.01, "selectionPressure": 0.3, "fitnessFunction": "gc-content", "targetValue": 0.5, "outputFormat": "detailed" }

Simulate sequence evolution on phylogenetic trees.

- rootSequence(required): Ancestral sequence
- treeStructure(optional): Newick format tree or "random"
- numTaxa(optional): Number of taxa for random tree (default: 5)
- mutationRate(optional): Mutation rate per branch length (default: 0.1)
- branchLengthVariation(optional): Branch length variation (default: 0.2)
- molecularClock(optional): Use molecular clock (default: true)
- substitutionModel(optional): "JC69", "K80", "HKY85", or "GTR"
- seed(optional): Random seed
- outputFormat(optional): "fasta", "nexus", or "phylip"

{ "rootSequence": "ATGCGATCGATCGATCG", "numTaxa": 8, "mutationRate": 0.05, "substitutionModel": "K80", "outputFormat": "nexus" }

Standard FASTA format with descriptive headers containing simulation parameters.

All tools provide detailed statistics including:

- Sequence composition analysis
- Mutation counts and types
- Evolutionary parameters
- Phylogenetic tree statistics

- NEXUS: For phylogenetic analysis software
- PHYLIP: For phylogenetic analysis
- JSON: Structured data with full simulation details

- Molecular Evolution Studies: Simulate sequence evolution under different models
- Phylogenetic Analysis: Generate test datasets with known evolutionary history
- Algorithm Testing: Create benchmark datasets for bioinformatics tools
- Educational Purposes: Demonstrate evolutionary principles

- Algorithm Validation: Test sequence analysis tools with controlled data
- Statistical Analysis: Generate null distributions for statistical tests
- Performance Benchmarking: Create datasets of varying complexity
- Method Comparison: Compare tools on simulated vs real data

- Jukes-Cantor (JC69): Equal substitution rates
- Kimura 2-Parameter (K80): Transition/transversion bias
- HKY85: Unequal base frequencies with transition bias
- GTR: General time-reversible model

- Markov Chains: Context-dependent nucleotide selection
- Codon Usage Bias: Realistic protein-coding sequences
- Amino Acid Properties: Hydrophobicity and disorder propensity

- Point Mutations: Single nucleotide/amino acid changes
- Indels: Insertion and deletion events
- Transition Bias: Realistic DNA mutation patterns

- @modelcontextprotocol/sdk: MCP framework
- zod: Schema validation
- typescript: Type safety
- Node.js: Runtime environment

This server provides a comprehensive framework for sequence simulation. Extensions could include:

- Additional substitution models
- Recombination simulation
- Population genetics models
- Structural constraints
- Codon usage tables for different organisms

This is a web browser that enables your coding agent, such as Claude Code, to visit websites on your behalf and assist you in identifying bugs or creating UI test cases.

A collection of 19 professional tools for chemical molecular processing based on the Model Context Protocol (MCP).

Performs gene set enrichment analysis using the Enrichr API, supporting all available gene set libraries.

An MCP server for the gget bioinformatics library, enabling standardized access to genomics tools and databases.

A unified framework for bioinformatics research, integrating multiple specialized MCP servers for longevity and bioinformatics.

Infer Copy Number Variations (CNVs) from single-cell RNA-Seq data using a natural language interface.

A natural language interface for cell-cell communication analysis using the Liana framework.

Enables conversational structural biology, molecular visualization, and analysis in PyMOL through natural language.

A quantum circuit simulator with noise models and OpenQASM 2.0 support, accessible via the Model Context Protocol (MCP).

Run real quantum experiments on real quantum hardware via natural language. Three MCP servers in one PyPI package: Quantum Inspire Tuna-9 (superconducting qubits), IBM Quantum, and quantum RNG. One-line install: claude mcp add qi-circuits -- uvx --from "quantum-vibecoding-mcp[qi]" qvc-qi

A natural language interface for single-cell RNA sequencing (scRNA-Seq) analysis using the Scanpy library.